E-ISSN 1658-8088 | ISSN 1658-807X
 

Review Article

Online Publishing Date:
09 / 01 / 2024

 


Mujahid Khan et al. JBC Genetics. 2023;6(2):106-118

Journal of Biochemical and Clinical Genetics

Nosology of genetic skeletal disorders, Pakistan: an updated review

Mujahid Khan1, Muhammad Umair2*

Correspondence to: Muhammad Umair

*Department of Life Sciences, School of Science, University of Management and Technology (UMT), Lahore, Pakistan.

Email: khugoo4u [at] yahoo.com

Full list of author information is available at the end of the article.

Received: 09 October 2023 | Accepted: 17 December 2023


ABSTRACT

Genetic skeletal disorders (GSDs) are heritably and clinically varied classes of bone and cartilage anomalies, characterized by irregular growth/development of the skeleton. They are rare, but their cases may be upraised with endogamy as it increases homozygosity. Pakistan has the highest rate (55%-60%) of consanguinity, which is quite worrying. Still, Pakistan has no reliable data (geographical prevalence, clinical, and epidemiological data) associated with GSDs and other rare genetic disorders. Unfortunately, due to the lack of adequate clinical/diagnostic resources and genetic knowledge, the suspected cases of genetic disorders are misdiagnosed and hence mistreated, thus, causing psycho-socioeconomic problems. The present study reviewed current literature, published on several Internet databases including the “Nosology of GSDs: (2023 Revision)” from Pakistan. GSDs such as acromesomelic dysplasia, mucopolysaccharidosis, polydactyly, synpolydactyly, and split hand/split foot malformation were reported in several families and have 55.04% of all the reported GSDs from Pakistan. To date, in the literature, 72 different mutated genes have been reported from the Pakistani community. This review will help clinicians and researchers in understanding, diagnosis, and management of GSDs and will offer a descriptive approach to carry out fruitful molecular genetic research in genetically vulnerable and low-resource regions. Moreover, it will also speed up the possible therapy development and may insist the stakeholders to establish a multi-level network to find a path towards the healthcare challenges of GSDs from Pakistan.


Keywords:

Prevalence, genetic skeletal disorders, skeletal dysplasia, Pakistani population.


Background

Genetic/hereditary skeletal disorders (GSDs) represent a diverse set of clinical/genetical conditions that arise from the mutations in different candidate genes resulting in disturbances of complex skeletal pathways of growth, development, and homeostasis. In contrast to the prevalent diseases, GSDs are rare and affect a very small fraction of people. However, due to the advent of next-generation sequencing (NGS) technologies, novel candidate genes are reported on a daily basis which has increased the number of rare genetic disorders (RGDs) and is thus currently recognized as one of the most significant global public health issues (1).

In developing countries, there are a number of difficulties like limited advanced clinical resources, and no or far localized genetic services centers, which hampered research and managing studies for GSDs. The proper diagnosis of GSDs is always a challenge because a variety of syndromic and nonsyndromic forms of GSDs affect a large number of people around the world, resulting in substantial healthcare costs and low quality of life (2,3). Despite numerous international initiatives to address the GSDs-associative problems, considerable work still needs to be done to deal with this ignored health sector, especially in Pakistan (4).

In recent times, advanced high-throughput, sequencing technologies such as whole genome sequencing and whole-exome sequencing have greatly increased our understanding of GSDs. The majority of the variants/mutations listed in Table 1 are identified by using recent advanced technology like NGS and with parallel Sanger sequencing method. Though 80% of rare disorders have a genetic origin and significant advances/discoveries are made every day, but still, approximately 65%-70% of causing genes/factors still need to be identified (5).

The nosology classification-2023 revision has classified the 771 different GSDs into 41 groups, on the basis of clinical, molecular, and radiographic diagnostics criteria, while only 552 genes have been associated with RGDs. The entire number of GSDs increased to 771 from 461 and the number of genes to 552 from 437; however, groups decreased from 42 to 41 due to regrouping and restructuring in the review of nosology-2023 classification (86).

Table 1. Up-to-date reported mutations and their candidate genes causing GSDs within the Pakistani community.

Gene name Phenotype/Disorder MIM Total number of variants Exact alteration in the DNA/Protein Mode of inheritance Homo/Hetero Reference
ALX1 FND1 (Frontonasal dysplasia) 136,760 5 c.661-1G>C; p.(?) AR Homo (6)
ALX3 FND1 136,760 3 c.604 C>T; p.(Gln202*) AR Homo (7)
BBS1 BBS1 (Bardet-Biedl syndrome1 ) 616,981 3 c.1339 G>A; p.(Ala447Thr), c.951+1G>A; p.(?) AD Homo (8)
BBS2 BBS2 (Bardet-Biedl syndrome2) 616,981 1 c.443A>T; p.Asn148Ile AR Homo (9)
BBS5 BBS5 (Bardet-Biedl syndrome5) 616,981 1 c.196delA; p.Arg66Glufs*12 AD Homo (8)
BHLHA9 MSSD 609,432 3 c.252_270delGCA; p.(Phe85Glufs*108) AR Homo (10)
BHLHA9 MSSD 609,432 5 c.211A>G; p.(Asn71Asp), c.218G>C; p.(Arg73Pro), c.211A>G; p.(Asn71Asp) AR Homo (10)
BHLHA9 MSSD 609,432 4 c.311T>C; p.(Ile104Thr) AR Homo (10)
BHLHA9 MSSD 609,432 3 c.409-409 deletion C p.(His137Thrfs*61) AR Homo (10)
BBIP1 BBS18 (Bardet-Biedl syndrome-18) 616,981 1 c.160A>T; p.(Lys54Ter) AR Homo (8)
BMPR1B AMDG (Acromesomelic dysplasia) 200,700 3 c.657 G>A; p.(Trp219*) AR Homo (11)
BMPR1B AMD3 (Acromesomelic dysplasia 3) 201,250 2 c.1190T>G; p.(Met397Arg) AR Homo (10)
Chr 13 PAPA5 263,450 5 Locus on chromosome 13q13.3-q21 AR Homo (10)
CC2D2A JBTS9 (Joubert syndrome 9) 612,285 1 c.4417C>G; p.Pro1473Ala AR Homo (12)
CHST3 SEDCJD 603,799 12 c.802G>T; p.Glu268* AR Homo (10)
CHST3 SEDCJD 603,799 4 c.590T>C; p.(Leu197Pro) AR Homo (13)
CHSY1 TPBS 605,282 3 c.1897 G>A; p.(Asp633Asn) AR Homo (14)
CLCN7 OPTB4 611,490 3 c.610 A>T, c.612 C>G; p.(Ser204Trp) AR Homo (15)
CLCN7 OPTB1 (Osteopetrosis) 259,700 2 c.2416T>A; p.*806Argext*58 AR Homo (16)
COL1A1 OI1 (Osteogenesis imperfecta 1) 166,200 1 c.1012G>A; p.Gly338Ser AR Homo (17)
COL10A1 MCDS 156,500 14 c.2011T>C; p.(Ser671Pro) AD Hetero (18)
COL10A1 MCDS 156,500 6 c.133C>T; p.(Pro45Ser) AD Hetero (10)
COMP PSACH (Pseudoachondroplasia) 177,170 16 c.1423 G>A; p.(Asp475Asn) AR Homo (19)
CTSK PYCD (Pycnodysostosis/Osteopetrosis) 265,800 4 c.136C>T; p.(Arg46Trp)
c.136C>T; p.(Arg46Trp)
c.266_268 del; p.(Lys89del), c.136 C>T; p.(Arg46Trp)
AR Homo and compound heterozygous (20)
CTSK PYCD 265,800 2 c.935C>T; p.(Ala277Val) AR Homo (21)
CTSK PYCD 265,800 3 c.728G>A; p.(Gly243Glu) AR Homo (22)
DLX5 SHFM 183,600 3 c.482-485dupACCT; p.(Ala163Profs*55) AD Hetero (23)
DLX6 SHFM 183,600 3 c.632 T>A p.(Val211Glu) AD Hetero (24)
DYM DMC 223,800 1 c.59T>A; p.(Leu20*) AR Homo (25)
DYM DMC 223,800 1 c.1205T>A; p.(Leu402Ter) AR Homo (26)
DYM DMC 223,800 1 c.95_96insT; p.(W33Lfs∗14) AR Homo (27)
EPS15L1 SHFM 183,600 3 c.409 deletion A; p.(Ser137Alafs*19) AR Homo (2)
ESCO2 RBS (Roberts syndrome) 268,300 1 c.879_880delAG; p.(Arg293fxX299) AR Homo (28)
EVC EVC (Ellis–van Creveld syndrome) 225,500 3 c.617G>A; p.(Ser206Asn) AR Homo (10)
EVC EVC 225,500 1 c.1932_1946dupAGCCCTCCGGAGGCT AR Homo (10)
EVC EVC 225,500 1 c.731_757del, c.731_757delTCCTTGACCTTCTTCCTAAAAAGAAGT AR Homo (29)
EVC2 EVC 225,500 1 c.702G>A; p.(Try234*) AR Homo (30)
EVC2 EVC 225,500 4 c.30dupC; p.(Thr11Hisfs*45) AR Homo (31)
EXT1 EXT 133,700 22 IVS1 ds +1G-C AD Hetero (10)
EXT1 EXT 133,700 1 c.247delC; p.(Arg83Gly) AD Hetero (32)
FAM92A PAPA9A 618,219 4 c.478C>T; p.(Arg160*) AR Homo (33)
FBN1 MFS 154,700 15 c.2368 T>A; p.(Cys790Ser) AD Hetero (34)
FBN1 MFS (Marfan syndrome) 134,797 1 c.1402A>G; p.Tyr468Ala AD Hetero (35)
FGFR1 ACH (Achondroplasia) 100,800 1 c.2407C > A; p.Pro803Thr AD Hetero (36)
FGFR3 ACH 100,800 1 c.1779C > G, p.F539L AD Hetero (37)
FGFR3 ACH 100,800 4 c.1138 G>A p.(Gly380Arg) AD Hetero (38)
FGFR3 ACH 100,800 2 c.1144 G>A p.(Gly382Arg) AD Hetero (39)
FKBP10 OI11 (Osteogenesis imperfecta 11) 607,063 7 c.1490 G4A p.(Trp497*), c.344G4A; p.Arg115Gln, and c.831dupC; p.Gly278ArgfsX295 AR Homo (40)
GALNS MPS4A (Mucopolysaccharidosis 4A) 612,222 18 p.(Phe216Ser), p.(Met38Arg), p.(Ala291Ser), p.(Glu121Argfs*37), p.(Pro420Arg), p.(Arg386Cys) AR Homo (10)
GALNS MPS4A 612,222 1 c.697G>A, p.Asp233Asn AR Homo (41)
GDF5 AMDG (Grebe chondrodysplasia) 200,700 5 c.157_158dupC; p.(Leu53Profs*41), c.872G>A; p.(Trp291*) AR Homo (42)
GDF5 AMDG 200,700 3 c.527 T>C, c.1114 ins GAGT AR Homo (10)
GDF5 AMDG 200,700 1 c.527 T>C, c.1114 ins GAGT AR Homo (10)
GDF5 BDC (Brachydactyly type C) 113,100 4 c.527 deletion T; p.(Leu176Argfs*17) AD Hetero (43)
GDF5 AMDG 200,700 1 c.404delC; p.(Pro135Gln*12 AR Homo (44)
GLB1 GM1G2 230,600 2 c.881-882 dele AT; p.(Tyr294Terfs) AR Homo (45)
GLI1 PAPA8A 618,123 5 c.337 C>T; p.(Arg113*) AR Homo (46)
GLI1 PPD1 (Pre-axial polydactyly) 174,400 3 c.1517 T>A; p.(Leu506Gln) AR Homo (47)
GLI1 PD1 (Polydactyly) 174,400 1 c.1133 C>T; P.(Ser378Leu) AR Homo (48)
GLI1 PAPA8 165,220 1 c.1064 C>A; p.(Thr355Asn AD Hetero (49)
GLI3 PAPA14 174,200 21 c.3635 dele G; p.(Gly1212Alafs*18) AD Hetero (50)
GLI3 GCPS 175,700 5 c.434-435 Inse G; p.(Tyr146Leufs*19), c.295-295 dele G; p.(Glu99Serfs*60), c.1622C>G;p.Thr541Arg; c.2374C>T; p.Arg792* AD Hetero (51)
GLI3 GCPS 175,700 3 c.3790_3791 Inse C, p.(Gly1236Argfs*, c.1692A > G, p.(His536Arg, c.1965_1966delAT; p.(His627Glufs*48 AD Hetero (52)
GLI3 PAP 174,200 1 c.3567_3568insG; p.Ala1190Glyfs*57 AD Hetero (53)
GNPNAT1 RHZDAN (Rhizomelic dysplasia) 619,598 1 c.226G>A; p.Glu76Lys AR Homo (54)
HOXD13 SPD1 (Synpolydactyly 1) 186,000 14 c.742 C>T; p.(Gln248X) AD Hetero (55)
HOXD13 SPD1 (Synpolydactyly 1) 186,000 60 c.184_210 dup, c.187_207 dup AD Hetero (10)
HOXD13 SPD1 (Synpolydactyly 1) 186,000 1 c.969G>T; p.Trp323Cys AD Hetero (56)
HPGD PHOAR1 259,100 3 c.577 T˃C ;p.(Ser193Pro) Homo (15)
IDUA MPS (Mucopolysaccharidosis) 607,014 11 p.(Leu490Pro) AR Homo (10)
IDUA MPS (Mucopolysaccharidosis) 607,014 2 c.1456 G>T; p.Glu486*, c.1469T>C; p.Leu490Pro AR Homo (57)
IDUA MPS (Mucopolysaccharidosis) 607,014 6 c.908T>C; p.L303P AR Homo (58)
IFT27 BBS (Bardet-Biedl syndrome) 616,981 1 c.94C>T; p.Gln32Ter AR Homo (8)
IQCE PAPA7 617,642 5 c.395-1G>A AR Homo (2,59)
KIAA0825 PAPA1 618,498 1 c.50T>C; p.Leu17Ser AR Homo (60)
KIAA0825 PAPA10 618,498 1 c.143 deletion G; p.Cys48Serfs*28 AR Homo (61)
LRP4 CLSS 212,780 6 c.316+1 G>A AR Homo (62)
LRP4 CLSS 212,780 10 c.2858 T>C; p.(Leu953Pro) AR Homo (63)
LRP4 CLSS 212,780 1 c.1151A>G; p.(Tyr384Cys) AR Hetero (10)
LRP4 CLSS 212,780 3 c.295G>C; p.Asp99His,
c.1633C>T; p.(Arg545Trp
AR Homo (64)
LZTFL1 BBS17 (Bardet-Biedl syndrome17) 616,981 1 c.505A>T; p.Lys169Ter AR Homo (8)
MATN3 SEMD 602,109 2 c.542G > A, p.Arg181Gln AR Homo (65)
MKKS BBS6 (Bardet-Biedl syndrome6) 616,981 1 c.775delA; p.Thr259Leufs*21c.119C>G; p.Ser40* AD Homo (66)
MKS1 JBTS (Joubert syndrome) 617,121 7 c.272_285 deletion ACGACCGCCTGGCA; p.(Asn91Ilefs*28) AR Homo (10)
NOTCH2 HJCYS (Hajduv Cheney syndrome) 102,500 1 c.6426_6427 insertion TT; p.(Glu2143Leufs*5) AD Hetero (67)
NPR2 AMDM 602,875 6 c.872 A>G; p.(Gln291Arg) AR Homo (68)
NPR2 AMDM 602,875 15 c.2720 C>T; p.(Thr907Met) c.2986+ 2 T>G AR Homo (69)
NPR2 AMDM 602,875 8 c.1801C>A; p.(Arg601Ser); c.2245C>T; p. (Arg749Trp), c.2986+2 T>G AR Homo (70)
NPR2 AMDM 602,875 1 c.613 C>T, p.R205X AR Homo (71)
OSTM1 OPTB1 (Osteopetrosis) 259,700 1 c.124del; p.Val42Serfs*57 AR Homo (10)
PAPSS2 SEMDJL 271,530 1 c.1037G>C; p.R346P AR Homo (72)
PCNT MOPDII 210,720 1 c.6176_6189delGTC AGC TGC CGA AG;p.Gln2060ArgfsTer48 AD Hetero (10)
PRG4 CACP 208,250 11 c.2816_2817 deletion AA; p.(Lys939fsX38) AR Homo (10)
RAB33B MOPDII 210,720 1 c.174delC; p.Asp60ThrfsTer7 AD Hetero (10)
RMRP CHH (Cartilage-hair hypoplasia) 250,250 2 g.70 A>G AR Homo (73)
ROR2 BDB1 (Brachydactyly type B1) 113,000 11 c.2278 C>T; p.(Gln760*) AD Hetero (74)
SP7 OI12 (Osteogenesis imperfecta 12) 613,848 1 c.824G >A; p.Cys275Tyr AR Homo (75)
SERPINF1 OI6 (Osteogenesis imperfecta 6) 613,982 1 c.397C>T; p.Gln133* AR Homo (76)
SERPINF1 OI 6 613,982 1 c.262_263insCCCTCTC; p.Ala91Profs*23 AR Homo (77)
SLCO2A1 PHOAR 259,100 1 c.664G>A; p.Gly222Arg AR Homo (40)
SPARC OI17 (Osteogenesis imperfecta 17) 616,507 1 c.497G>A; p.Arg166His AR Homo (78)
STKLD1 PPD (Pre-Axial polydactyly) 174,400 3 c.84C>A; p.(Tyr28*) AR Homo (79)
TBX2 OCD (Osteochondrodysplasia) 616,897 1 c.529A>T; p.(Lys177*) AD Homo (80)
TCIRG1 OPTB1 (Osteopetrosis 1) 259,700 2 c.624 deletion C; p.(Pro208fsX) AR Homo (10)
TCIRG1 OPTB1 259,700 7 c.515G>A; p.(Gly172Asp), c.854_855 del; p.(Val285Alafs*204), c.2416 T>A; p.(*806Argext*58), c.971 dup; p.(Cys324Trpfs*166) AR Homo (10,16)
TMEM67 MKS3 (Meckel syndrome 3) 607,361 2 c.1575+1G>A, c.870-2A>G AR Homo (81)
TP63 SHFM 225,300 1 c.956G>A; p.(Arg319His) AD Hetero (82)
TRPS1 TRPS3 190,351 6 c.2762 G>T; p.(Gly921Val) AD Hetero (10)
TRPS1 TRPS3 190,351 4 c.2762 G>A; p.(Arg921Gln) AD Hetero (5)
WDPCP BBS15 (Bardet-Biedl syndrome 15) 616981 2 c.720 C>A; p.Cys240Ter AR Homo (8)
WNT1 OI15 (Osteogenesis imperfecta 15) 615,220 7 c.1168 G>T; p.(Gly324Cys) AR Homo (83)
WNT1 OI15 615,220 3 c.359-3C>G AR Homo (2)
WNT1 OI15 615,220 1 c.359-3C>G, c.677 C>T; p.(Ser226Leu) AR Homo (57)
WNT10B SHFM 225,300 5 c.460C>G; p.(Gln154*), c.300_306 dup AGGGCGG; p.(Leu103Argfs*53) AR Homo (84)
WNT10B SHFM 225,300 7 c.1165_1168delAAGT, c.300_306 dupAGGGCGG AR Homo (10)
WNT 10B SHFM 225,300 1 c.1098C>A; p.(Cys366∗) AR Homo (85)
WNT 10B SHFM 225,300 2 c.338G>A; p.(Gly113Asp),
c.884-896delTCCAGCCCCGTCT; p.(Phe295Cysfs*87)
AR Homo (77)
WNT10B SHFM 225,300 9 c.986C>G; p.(Thr329Arg) AR Homo (10)
Xq26.3 loci SHFM2 313,350 35 Gene position on chromosome Xq26.3 X linked ---------- (10)
ZNF141 PAPA6A 615,226 3 c.1420 C>T p.(Thr474Ile) AR Hetero (10)
ZRS PPD, PSD, PAPD, TPT (Pre-axial polydactyly, syndactyly, postaxial-polydactyly and triphalangeal thumb) 605,522 14 Intrinsic ZRS 287 C>A AD Hetero (10)
ZRS TPT/PPD (Triphalangeal Thumb/Preaxial polydactyly) 605,522 13 Intrinsic ZRS 463 T>G AD Hetero (10)

Table 2. Province-wise number of GSDs reported and published from each province of Pakistan.

Province Total GSDs reported Percent of total GSDs (%)
Punjab 247 40.56
Sindh 219 35.96
Khyber Pakhtunkhwa 116 19.05
Kashmir 19 3.12
Balochistan 8 1.31
Gilgit-Baltistan 0 0.00

The nosology classification-2023 revision is more helpful in the identification of novel skeletal disorders and provides an excellent framework for a better understanding of the underlying mechanisms essential for regular skeletal growth, maintenance, and development (86). Based on the nosology classification-2023 revision, this is our second effort at population research studies to display the prevalence and pervasiveness of GSDs in Pakistan (10).

The reasons that stimulate us to compile and publish a second revision of GSDs is to facilitate research and diagnosis by sharing fresh knowledge about the growing number and variety of GSDs. Commonly in Pakistani society, GSD has an autosomal dominant or recessive mode of inheritance.

Skeletal dysplasia

Skeletal dysplasia is the heterogeneous camp of RGDs occurrence rate of 1 in every 5,000 live births (87). Mutations in several genes are associated with skeletal disorders that might affect the development, structure, or function of the skeletal system. They may have autosomal dominant, autosomal recessive, X-linked dominant, or X-linked recessive or as a de novo mode of inheritance (87). GSDs display varied clinical conditions ranging from a particular organ to multisystematic disorder and are due to defects/mutations in a variety of gene families, including genes encoding transcription factors, extracellular matrix proteins, tumor suppressors, ligands, channel proteins, receptors, enzymes, cellular transporters, intracellular binding and morphogenic proteins, chaperones, RNA processing molecules, cytoplasmic proteins, cilia, and others. Moreover, exposure to teratogen, somatic mosaicism, and imprinting errors may lead to GSDs (87).

In practice, the distinction between different types of skeletal disorders is often implausible due to analogous disease patterns including radiographic and molecular findings and clinical manifestation. GSDs may be classified as skeletal dysplasia or dysostoses on the basis of anomalies in pattern, differentiation, linear development, and maintenance of skeletal tissues (88,89). Skeletal dysplasia is a broad term referring to abnormalities of bone and cartilage that result in unbalanced stature, size, and shape of the skeleton. They primarily affect the development of cartilage and bone (due to the mutation in genes regulating the development, growth, and maintenance of bone/cartilage) but muscles, tendons, and ligaments may also be affected (89,90). On the other hand, dysostosis refers to anomalies in the ossification of one or more bones due to mutation of genes involved in skeletal patterning. They often occur in conjunction with other inherited disorders in the form of spondylocostal dysostosis, cleidocranial dysostosis, and limb deformities such as polydactyly, brachydactyly, and syndactyly (91,92).

To categorize the newly reported genes and disorders, the International Skeletal Dysplasia Society completed its most recent revision in 2023, which revealed a novel molecular and pathological concept of GSDs. In their recent analysis, Unger et al. (86) divide 771 disorders into 41 groups with only 552 known associated candidates’ genes.

The present study is coping with sufficient and to-date information on GSD phenotypes reported by the Pakistani community and has systematically evaluated them. The appraisal also comprehensively analyzed, explored, and emphasized all the challenges and concerns associated with accurate diagnosis and proper treatment of GSDs, especially life-threatening GSDs.


Methodology

The current study covered and reported all 552 known GSD candidates’ genes, which were grouped into 41 categories in the “Nosology of GSDs (2023 revision).”

Research approaches

All reported GSD genes were obtained from the “Nosology of GSDs (2023 revision).” The search was conducted by entering the mesh “gene name” and “Pakistan” by using various online accessible databases and search browsers such as OMIM, Google Scholar, PubMed, HMGD, and Research Gate.


Results

In the existing literature, 559 cases of GSDs are documented in 21 different groups of the “Nosology of GSDs (2023 revision)” from the Pakistani community. Table 1 lists details of all the pathogenic mutations reported from the Pakistani community till now. SHFM, Synpolydactyly, Polydactyly, Acromesomelic dysplasia/short-limb dwarfism (AMDH, AMDG, AMDM), and Glycosaminoglycans (Mucopolysaccharidosis) are five most reported GSDs, accounting for 14.19%, 13.18%, 11.51%, 7.8%, and 5.5%, respectively (Tables 1 and 2). Figure 1A and B illustrates the geographical prevalence of GSDs in Pakistan. However, this time a significantly higher number of cases were reported from the Punjab province (40.56%), compared to the GSD 2019, in which Sindh province was at the top with 40.38% GSD cases and Punjab was second with 39.04 of all the cases. All the numbers and details of GSDs reported so far from each province (Pakistan) have been listed in Table 2.

Figure 1. (A) Provinces-wise percent prevalence of hereditary skeletal disorders reported and published from Pakistan. (B) Number-wise graphical representation of different GSDs reported from Pakistani provinces. Punjab province is showing the highest reports.


Discussion

The term GSD is commonly used to describe bone and cartilage abnormalities. It is a very heterogeneous class of anomalies that result from the mutations of numerous genes, causing disruption in the organization and function of the growth plate. It can range from mild (polydactyly, and so on) to severe/lethal (thoracic hypoplasia, and so on) and from nonsyndromic to syndromic. Genotypically, GSD has both dominant (autosomal/X-linked) and recessive (autosomal/X-linked) forms of inheritance. Keeping in mind the challenges of the precise diagnosis and evaluation of the GSDs, it is important to obtain family history, physical examination, a full set of skeletal radiographs/photographs, audiogram, magnetic resonance imaging, and complete medical records (93).

Currently, Pakistan is the 5th most populous country in the world (241.49 million with a growth rate of 2.55% (census 2023); having five provinces (Balochistan, Gilgit-Baltistan, Khyber Pakhtunkhwa Punjab, and Sindh), and Pakistan administered territories of Azad Jammu and Kashmir (4.045 million populations (census 2017). All GSD cases reported from Pakistan to date include Punjab (40.56%), Sindh (35.96%), KPK (19.05%), Balochistan (1.31%), and Kashmir (3.12%), while from Gilgit-Baltistan still no case has been reported (Figure 1A and B).

Although very little information is available about the prevalence of genetic disorders in Pakistan, the statistics from Europe and golf countries point to a concerning situation for Pakistan, as cousin marriage drastically increases genetic disorders and Pakistan has the highest rate of cousin marriage. For example, Europe has less than 1% cousin marriages with 1/5,000 live births affected by a genetic disorder, while Qatar has 54% consanguinity with 1/1,300 affected birth individuals (94).

According to studies, cousins marry each other in about 55%-60% of marriages in the nation. Numerous cultural, social, and economic factors contribute to this high prevalence. The prevailing cultural and societal norms in Pakistan that encourage cousin marriages are a major contributing factor to the high number of these marriages. In many cultures, getting married within the extended family is seen as a means of preserving inherited wealth and ties to the family. Cousin marriages are also frequently viewed as the best option because of their apparent compatibility and shared morals. However, there are certain negative consequences associated with the prevalence of cousin marriages in Pakistan, including economic burdens. Consanguineous marriages can lead to an increased risk of genetic disorders and disabilities in offspring. Research has shown that the children of cousin marriages are more likely to suffer from birth defects, developmental delays, and other hereditary conditions (85). In addition, the majority of mutations found in the Pakistani population are biallelic; however, heterozygous mutations are also common.

According to Umair (5), 65%-70% of casual genes of RGDs have to be identified; moreover, recently the “Nosology of GSDs (2023)” has reported many novel GSDs worldwide. Developing countries like Pakistan, where 60% of people are below the line in poverty, have no concept of proper testing and have no database or any other organization for the entry and registration of RGDs including GSDs. Even though, the Pakistani population has a high rate of consanguineous marriage, researchers and physicians have little to no documented information.

The current analysis reveals that in the last two decades number and kind of GSDs in Pakistan have rapidly increased due to the powerful NGS screening technologies. Especially, in the last 10 years publications and reports about genetic rare disorders have increased by 99%. That is why GSDs and their causing genes/mutations have a relatively high novelty rate reporting from Pakistan. The aim of this revision is to provide bridges among clinicians, scientists, and genetics interested in GSDs and in skeletal biology, through the list of GSDs and their causative genes, mutations, pathways, and other associated spectrums. Moreover, it will also ensure a proper diagnosis, as this review holds the treasure of detail and novel information on GSDs (95).

GSDs are a complicated and diverse set of disorders caused by 552 different genes, making it very challenging to identify the exact disorder (5). Monogenetic disorders are very rare but it is helpful to identify the specific gene function and to track down its associated molecular pathways. Studying the pathogenicity of various mutations that occur in different genes sheds light on the potential prevention measures, diagnostic tools, treatment, and a necessary step for providing correct genetic counseling. In modern times, there has been significant progress in molecular/genetic diagnosis (such as NGS, and so on) to confirm clinical/radiographic diagnosis and to predict the risk level of a family for GSDs. Moreover, targeting these molecular pathways has encouraging results both in vitro and in vivo even though these therapies are still under the research and developmental stage (84).

Despite the paucity of research on GSDs in Pakistan, efforts have been made to comprehend, diagnose, and treat these severe conditions. Pakistan’s medical community has been actively involved in the diagnosis, treatment, and management of patients with skeletal dysplasias and other genetic conditions. A significant obstacle in carrying out investigations on GSDs in Pakistan is their uncommon occurrence, which makes it hard to locate enough afflicted people for thorough examinations. Precise diagnosis and treatment of these disorders are further complicated by the fact that certain areas of the nation lack access to specialized genetic testing facilities and knowledge.

The future management of GSDs is likely to be influenced by advancements in genetics, molecular biology, and medical technology. Potential developmental areas that can improve our understanding include precision medicine, CRISPR-Cas9-based gene therapy, stem cell therapies, pre-genetic testing, and early interventions (83,94).

Future studies may focus on the discovery of therapy for GSDs by finding new therapeutic drugs that more specifically affect this integrated signaling network and enhance the delivery of therapeutics to the growth plate. Moreover, in Pakistan, a sound medical policy and establishing robust collaborative partnerships abroad is required. At each big city, a department for genetic counseling through the multidisciplinary approach (including orthopedists, rheumatologists, otolaryngologists, gynecologists, neurologists, ophthalmologists, and so on, having genetically knowledge and experience) should be established for RGDs. This would considerably reduce the likelihood of misdiagnosis and will make it easy to enhance treatment for patients of RGDs.


Conclusion

In conclusion, the main goal of the present systematic revision is to summarize the detailed information on the rare and ultra-rare GSDs on the number, geographic, and molecular genetic bases affecting the Pakistani community. Thus, updating the current literature of GSDs in Pakistan according to the recent nosology classification 2023 (5). Where, it will provide an exact roadmap to proper diagnosis, awareness, and approaches to successful molecular research, as well as it will elaborate on the pathological mechanism of GSDs. Furthermore, it will also accelerate understanding of the potential therapy development and will urge researchers, geneticists, clinicians, and other policymakers to establish a multilevel network organization that might offer a proper solution to diagnosis, treatment, and care to patients suffering from GSDs in Pakistan.


Acknowledgment

The author would like to thank UMT for its support.


List of Abbreviations

ACH Achondroplasia
AMDH Acromesomelic dysplasia Hunter–Thompson
AMDG Acromesomelic dysplasia Grebe type
AMD Acromesomelic dysplasia
AMDM Acromesomelic dysplasia type Maroteaux
BBS Bardet-Biedl syndrome
BDB1 Brachydactyly type B1
BDC Brachydactyly type C
CHH Cartilage-hair hypoplasia
CLSS Cenani-Lenz syndactyly syndrome with oro-facial and skeletal symptoms
DMC Dyggve-Melchior-Clausen disease
EVC Ellis–van Creveld syndrome
EXT Multiple hereditary exostoses
FND Frontonasal dysplasia
GCPS Greig cephalopolysyndactyly syndrome
GM1G Infantile GM1 gangliosidosis
GSDs Genetic skeletal disorders
HJCYS Hajduv Cheney syndrome
HMGD Health Ministers Discretionary Grant
ISDS International Skeletal Dysplasia Society
JBTS Joubert syndrome
MCDS Chondrodysplasia
MFS Marfan syndrome
MKS3 Meckel syndrome
MOPDII Microcephalic osteodysplastic primordial dwarfism
MPS Mucopolysaccharidosis
MPS4A Mucopolysaccharidosis 4A
MSSD Mesoaxial synostotic syndactyly
NGS Next-generation sequencing
OCD Osteochondrodysplasia
OI1 Osteogenesis imperfecta
OMIM Online Mendelian inheritance in man
OPTP Osteopetrosis
PAPA Postaxial polydactyly types
PD1 Polydactyly
PHOAR Hypertrophic osteoarthropathy autosomal recessives
PPD1 Pre-axial polydactyly
PSACH Pseudoachondroplasia
PYCD Pycnodysostosis
RBS Roberts syndrome
RGDs Rare genetic disorders
RHZDAN Rhizomelic dysplasia
SEMD Spondyloepimetaphyseal dysplasia
SEDCJD Spondyloepiphyseal dysplasia with congenital joint dislocations
SHFM Split-hand/foot malformation
SPD Synpolydactyly
TRPS Trichorhinophalangeal syndrome type
TPT Triphalangeal thumb
UMT University of Management and Technology

Declaration of conflicting interests

The author declares that there is no conflict of interest regarding the publication of this case report.


Financial support

None.


Consent to participate

Not applicable.


Ethical approval

Not applicable.


Author contributions

Mujahid Khan collected the data and drafted the manuscript. Conception and design of the work: Umair M.


Author details

Mujahid Khan1, Muhammad Umair2

  1. Center of Animal Nutrition, Livestock and Dairy Development (Research) Department, Peshawar, Pakistan
  2. Department of Life Sciences, School of Science, University of Management and Technology (UMT), Lahore, Pakistan

References

  1. Schieppati A, Henter JI, Daina E, Aperia A. Why rare diseases are an important medical and social issue. Lancet. 2008 Jun;371(9629):2039–41. https://doi.org/10.1016/S0140-6736(08)60872-7
  2. Umair M, Shah K, Alhaddad B, Haack TB, Graf E, Strom TM, et al. Exome sequencing revealed a splice site variant in the IQCE gene underlying post-axial polydactyly type A restricted to lower limb. Eur J Hum Genet. 2017 Aug;25(8):960–5. https://doi.org/10.1038/ejhg.2017.83
  3. Umair M, Ullah A, Abbas S, Ahmad F, Basit S, Ahmad W. First direct evidence of involvement of a homozygous loss-of-function variant in the EPS15L1 gene underlying split-hand/split-foot malformation. Clin Genet. 2018 Mar;93(3):699–702. https://doi.org/10.1111/cge.13152
  4. Abbas S, Khan H, Qamre Alam Q, Arif Mahmood A, Umair M. Genetic advances in skeletal disorders: an overview. JBC Genetics. 2023;6(1):57–69. https://doi.org/10.24911/JBCGenetics/183-1672021989
  5. Umair M. Rare genetic disorders: beyond whole-exome sequencing. J Gene Med. 2023 Oct;25(10):e3503. https://doi.org/10.1002/jgm.3503
  6. Ullah A, Kalsoom UE, Umair M, John P, Ansar M, Basit S, et al. Exome sequencing revealed a novel splice site variant in the ALX1 gene underlying frontonasal dysplasia. Clin Genet. 2017 Mar;91(3):494–8. https://doi.org/10.1111/cge.12822
  7. Ullah A, Umair M, E-Kalsoom U, Shahzad S, Basit S, Ahmad W. Exome sequencing revealed a novel nonsense variant in ALX3 gene underlying frontorhiny. J Hum Genet. 2018 Jan;63(1):97–100. https://doi.org/10.1038/s10038-017-0358-y
  8. Nawaz H, Mujahid, Khan SA, Bibi F, Waqas A, Bari A, et al. Biallelic variants in seven different genes associated with clinically suspected Bardet-Biedl syndrome. Genes. 2023 19;14(5):1113. https://doi.org/10.3390/genes14051113
  9. Ali G, Sadia, Foo JN, Nasir A, Chang CH, Chew EG, et al. Identification of a novel homozygous missense (c. 443A> T: p. N148I) mutation in BBS2 in a Kashmiri family with Bardet-Biedl syndrome. BioMed Res Int. 2021 Feb;2021:6626015. https://doi.org/10.1155/2021/6626015
  10. Umair M, Ahamd F, Bilal M, Asiri A, Younus M, Khan A. A comprehensive review of genetic skeletal disorders reported from Pakistan: a brief commentary. Meta Gene. 2019;20:100559. https://doi.org/10.1016/j.mgene.2019.100559
  11. Graul-Neumann LM, Deichsel A, Wille U, Kakar N, Koll R, Bassir C, et al. Homozygous missense and nonsense mutations in BMPR1B cause acromesomelic chondrodysplasia-type Grebe. Eur J Hum Genet. 2014 Jun;22(6):726–33. https://doi.org/10.1038/ejhg.2013.222
  12. Khan MI, Latif M, Saif M, Ahmad H, Khan AU, Naseer MI, et al. Whole exome sequencing identified a novel missense alteration in CC2D2A causing Joubert syndrome 9 in a Pakhtun family. J Gene Med. 2021 Jan;23(1):e3279. https://doi.org/10.1002/jgm.3279
  13. Kausar M, Ain NU, Hayat F, Fatima H, Azim S, Ullah H, et al. Biallelic variants in CHST3 cause Spondyloepiphyseal dysplasia with joint dislocations in three Pakistani kindreds. BMC Musculoskelet Disord. 2022 Aug;23(1):818. https://doi.org/10.1186/s12891-022-05719-6
  14. Sher G, Naeem M. A novel CHSY1 gene mutation underlies Temtamy preaxial brachydactyly syndrome in a Pakistani family. Eur J Med Genet. 2014 Jan;57(1):21–4. https://doi.org/10.1016/j.ejmg.2013.11.001
  15. Khan MA, Ullah A, Naeem M. Whole exome sequencing identified two novel homozygous missense variants in the same codon of CLCN7 underlying autosomal recessive infantile malignant osteopetrosis in a Pakistani family. Mol Biol Rep. 2018 Aug;45(4):565–70. https://doi.org/10.1007/s11033-018-4194-8
  16. Liu C, Ajmal M, Akram Z, Ghafoor T, Farhan M, Shafique S, et al. Genetic analysis of osteopetrosis in Pakistani families identifies novel and known sequence variants. BMC Med Genomics. 2021 Nov;14(1):264. https://doi.org/10.1186/s12920-021-01117-4
  17. Tauseef U, Ibrahim M, Asghar MS, Tauseef A, Zafar M, Rasheed U, et al. Osteogenesis imperfecta-serine replacing glycine in the COL1A1 gene-A new establishment in genetics. Fortune J Rheumatol. 2020;2(2):61–6. https://doi.org/10.26502/fjr.26880018
  18. Zhang C, Liu J, Iqbal F, Lu Y, Mustafa S, Bukhari F, et al. A missense point mutation in COL10A1 identified with whole-genome deep sequencing in a 7-generation Pakistan dwarf family. Heredity (Edinb). 2018 Jan;120(1):83–9. https://doi.org/10.1038/s41437-017-0021-6
  19. Tariq M, Khan TN, Lundin L, Jameel M, Lönnerholm T, Baig SM, et al. Homozygosity for a missense variant in COMP gene associated with severe pseudoachondroplasia. Clin Genet. 2018 Jan;93(1):182–6. https://doi.org/10.1111/cge.13091
  20. Pangrazio A, Puddu A, Oppo M, Valentini M, Zammataro L, Vellodi A, et al. Exome sequencing identifies CTSK mutations in patients originally diagnosed as intermediate osteopetrosis. Bone. 2014 Feb;59:122–6. https://doi.org/10.1016/j.bone.2013.11.014
  21. Naeem M, Sheikh S, Ahmad W. A mutation in CTSK gene in an autosomal recessive pycnodysostosis family of Pakistani origin. BMC Med Genet. 2009 Aug;10(1):76. https://doi.org/10.1186/1471-2350-10-76
  22. Khan B, Ahmed Z, Ahmad W. A novel missense mutation in cathepsin K (CTSK) gene in a consanguineous Pakistani family with pycnodysostosis. J Investig Med. 2010 Jun;58(5):720–4. https://doi.org/10.2310/JIM.0b013e3181da50bd
  23. Ullah A, Ullah MF, Khalid ZM, Ahmad W. Novel heterozygous frameshift mutation in distal-less homeobox 5 underlies isolated split hand/foot malformation type 1. Pediatr Int. 2016 Dec;58(12):1348–50. https://doi.org/10.1111/ped.13023
  24. Abdullah, Shah PW, Nawaz S, Hussain S, Ullah A, Basit S, et al. A homozygous nonsense variant in DYM underlies Dyggve-Melchior-Clausen syndrome associated with ectodermal features. Mol Biol Rep. 2020 Sep;47(9):7083–8. https://doi.org/10.1007/s11033-020-05774-z
  25. Bakar A, Shams S, Bibi N, Ullah A, Ahmad W, Jelani M, et al. A novel homozygous nonsense variant in the DYM underlies Dyggve-Melchior-Clausen syndrome in large consanguineous family. Genes (Basel). 2023 Feb;14(2):510. https://doi.org/10.3390/genes14020510
  26. Gaboon NE, Parveen A, Ahmad KA, Shuaib T, Al-Aama JY, Abdelwehab L, et al. A novel homozygous frameshift variant in DYM causing Dyggve-Melchior-Clausen syndrome in Pakistani patients. Front Pediatr. 2020 Jul;8:383. https://doi.org/10.3389/fped.2020.00383
  27. Schulz S, Gerloff C, Ledig S, Langer D, Volleth M, Shirneshan K, et al. Prenatal diagnosis of roberts syndrome and detection of an ESCO2 frameshift mutation in a Pakistani family. Prenat Diagn. 2008 Jan;28(1):42–5. https://doi.org/10.1002/pd.1904
  28. Zaka A, Shahzad S, Rao HZ, Kanwal S, Gul A, Basit S. An intrafamilial phenotypic variability in Ellis-Van Creveld syndrome due to a novel 27 bps deletion mutation. Am J Med Genet A. 2021 Oct;185(10):2888–94. https://doi.org/10.1002/ajmg.a.62360
  29. Umair M, Seidel H, Ahmed I, Ullah A, Haack TB, Alhaddad B, et al. Ellis-van Creveld syndrome and profound deafness resulted by sequence variants in the EVC/EVC2 and TMC1 genes. J Genet. 2017 Dec;96(6):1005–14. https://doi.org/10.1007/s12041-017-0868-6
  30. Ajmal M, Muhammad H, Nasir M, Shoaib M, Malik SA, Ullah I. Haploinsufficiency of EXT1 and heparan sulphate deficiency associated with hereditary multiple exostoses in a Pakistani family. Medicina (Kaunas). 2022 Dec;59(1):100. https://doi.org/10.3390/medicina59010100
  31. Schrauwen I, Giese AP, Aziz A, Lafont DT, Chakchouk I, Santos-Cortez RL, et al. FAM92A underlies nonsyndromic postaxial polydactyly in humans and an abnormal limb and digit skeletal phenotype in mice. J Bone Miner Res. 2019 Feb;34(2):375–86. https://doi.org/10.1002/jbmr.3594
  32. Micheal S, Khan MI, Akhtar F, Weiss MM, Islam F, Ali M, et al. Identification of a novel FBN1 gene mutation in a large Pakistani family with Marfan syndrome. Mol Vis. 2012;18:1918–26.
  33. Farooqi N, Metherell LA, Schrauwen I, Acharya A, Khan Q, Nouel Saied LM, et al. Exome sequencing identifies a novel FBN1 variant in a Pakistani family with Marfan syndrome that includes left ventricle diastolic dysfunction. Genes (Basel). 2021 Nov;12(12):1915. https://doi.org/10.3390/genes12121915
  34. Mustafa S, Akhtar Z, Asif M, Amjad M, Ijaz M, Latif M, et al. Novel missense variants in FGFR1 and FGFR3 causes short stature in enrolled families from Pakistan. Meta Gene. 2020;26:100778. https://doi.org/10.1016/j.mgene.2020.100778
  35. Ajmal M, Mir A, Shoaib M, Malik SA, Nasir M. Identification and in silico characterization of p.G380R substitution in FGFR3, associated with achondroplasia in a non-consanguineous Pakistani family. Diagn Pathol. 2017 Jul;12(1):47. https://doi.org/10.1186/s13000-017-0642-3
  36. Parveen A, Arif A. Identification of novel missense pathogenic variant in Fgfr3 gene causing achondroplasia (Ach) in Pakistani patients. J Xi’an Shiyou Univ Nat Sci Ed. 66(1).
  37. Umair M, Hassan A, Jan A, Ahmad F, Imran M, Samman MI, et al. Homozygous sequence variants in the FKBP10 gene underlie osteogenesis imperfecta in consanguineous families. J Hum Genet. 2016 Mar;61(3):207–13. https://doi.org/10.1038/jhg.2015.129
  38. Ghafoor S, Silveira KD, Qamar R, Azam M, Kannu P. Exome sequencing identifies a biallelic GALNS variant (p. Asp233Asn) causing mucopolysaccharidosis type IVA in a Pakistani consanguineous family. Genes (Basel). 2022 Sep;13(10):1743. https://doi.org/10.3390/genes13101743
  39. Umair M, Rafique A, Ullah A, Ahmad F, Ali RH, Nasir A, et al. Novel homozygous sequence variants in the GDF5 gene underlie acromesomelic dysplasia type-grebe in consanguineous families. Congenit Anom (Kyoto). 2017 Mar;57(2):45–51. https://doi.org/10.1111/cga.12187
  40. Ullah A, Umair M, Hussain S, Jan A, Ahmad W. Sequence variants in GDF5 and TRPS1 underlie brachydactyly and tricho-rhino-phalangeal syndrome type III. Pediatr Int. 2018 Mar;60(3):304–6. https://doi.org/10.1111/ped.13473
  41. Faryal S, Farooq M, Abdullah U, Ali Z, Saadi SM, Ullah F, et al. A GDF5 frameshift mutation segregating with Grebe type chondrodysplasia and brachydactyly type C+ in a 6 generations family: clinical report and mini review. Eur J Med Genet. 2021 Jul;64(7):104226. https://doi.org/10.1016/j.ejmg.2021.104226
  42. Zubaida B, Almas Hashmi M, Arshad Cheema H, Naeem M. Identification of a novel GLB1 mutation in a consanguineous Pakistani family affected by rare infantile GM1 gangliosidosis. J Genet. 2018 Dec;97(5):1445–9. https://doi.org/10.1007/s12041-018-1002-0
  43. Palencia-Campos A, Ullah A, Nevado J, Yildirim R, Unal E, Ciorraga M, et al. GLI1 inactivation is associated with developmental phenotypes overlapping with Ellis-van Creveld syndrome. Hum Mol Genet. 2017 Dec;26(23):4556–71. https://doi.org/10.1093/hmg/ddx335
  44. Ullah A, Umair M, Majeed AI, Abdullah, Jan A, Ahmad W. A novel homozygous sequence variant in GLI1 underlies first case of autosomal recessive pre-axial polydactyly. Clin Genet. 2019 Apr;95(4):540–1. https://doi.org/10.1111/cge.13495
  45. Bakar A, Ullah A, Bibi N, Khan H, Rahman AU, Ahmad W, et al. A novel homozygous variant in the GLI1 underlies postaxial polydactyly in a large consanguineous family with intra familial variable phenotypes. Eur J Med Genet. 2022 Oct;65(10):104599. https://doi.org/10.1016/j.ejmg.2022.104599
  46. Yousaf M, Ullah A, Azeem Z, Isani Majeed A, Memon MI, Ghous T, et al. Novel heterozygous sequence variant in the GLI1 underlies postaxial polydactyly. Congenit Anom (Kyoto). 2020 Jul;60(4):115–9. https://doi.org/10.1111/cga.12361
  47. Mumtaz S, Yıldız E, Lal K, Tolun A, Malik S. Complex postaxial polydactyly types A and B with camptodactyly, hypoplastic third toe, zygodactyly and other digit anomalies caused by a novel GLI3 mutation. Eur J Med Genet. 20171;60(5):268–74. https://doi.org/10.1016/j.ejmg.2017.03.004
  48. Abdullah YM, Yousaf M, Azeem Z, Bilal M, Liaqat K, Hussain S, et al. Variants in GLI3 cause Greig cephalopolysyndactyly syndrome. Genet Test Mol Biomarkers. 2019 Oct;23(10):744–50. https://doi.org/10.1089/gtmb.2019.0071
  49. Khan H, Abdullah, Ahmed S, Nawaz S, Ahmad W, Rafiq MA. Greig cephalopolysyndactyly syndrome: phenotypic variability associated with variants in two fifferent fomains of GLI3. Klin Padiatr. 2021 Mar;233(2):53–8. https://doi.org/10.1055/a-1223-2489
  50. Umair M, Wasif N, Albalawi AM, Ramzan K, Alfadhel M, Ahmad W, et al. Exome sequencing revealed a novel loss-of-function variant in the GLI3 transcriptional activator 2 domain underlies nonsyndromic postaxial polydactyly. Mol Genet Genomic Med. 2019 Jul;7(7):e00627. https://doi.org/10.1002/mgg3.627
  51. Ain NU, Baroncelli M, Costantini A, Ishaq T, Taylan F, Nilsson O, et al. Novel form of rhizomelic skeletal dysplasia associated with a homozygous variant in GNPNAT1. J Med Genet. 2021 May;58(5):351–6. https://doi.org/10.1136/jmedgenet-2020-106929
  52. Kurban M, Wajid M, Petukhova L, Shimomura Y, Christiano AM. A nonsense mutation in the HOXD13 gene underlies synpolydactyly with incomplete penetrance. J Hum Genet. 2011 Oct;56(10):701–6. https://doi.org/10.1038/jhg.2011.84
  53. Abbas S, Ahmad F, Kanwal M, Sultan A, Said G, Umair M. Novel heterozygous sequence variant in the HOXD13 gene underlie non-syndromic syndactyly. J Biochem Clin Genet. 2023; 6(1):0. https://doi.org/10.24911/JBCGenetics/183-1672678766
  54. Gul R, Firasat S, Hussain M, Afshan K, Nawaz D. IDUA gene mutations in mucopolysaccharidosis type-1 patients from two Pakistani inbred families. Congenit Anom (Kyoto). 2020 Jul;60(4):126–7. https://doi.org/10.1111/cga.12354
  55. Zahoor MY, Cheema HA, Ijaz S, Anjum MN, Ramzan K, Bhinder MA. Mapping of IDUA gene variants in Pakistani patients with mucopolysaccharidosis type 1. J Pediatr Endocrinol Metab. 2019 Nov;32(11):1221–7. https://doi.org/10.1515/jpem-2019-0188
  56. Bilal M, Raheel M, Hassan G, Zeb S, Mahmood A, Zehri Z, et al. A biallelic variant in IQCE predisposed to cause non-syndromic post-axial polydactyly type A. J Biochem Clin Genet. 2023;6(1):29–35. https://doi.org/10.24911/JBCGenetics/183-1673499250
  57. Hayat A, Umair M, Abbas S, Rauf A, Ahmad F, Ullah S, et al. Identification of a novel biallelic missense variant in the KIAA0825 underlies postaxial polydactyly type A. Genomics. 2020 Jul;112(4):2729–33. https://doi.org/10.1016/j.ygeno.2020.03.006
  58. Bilal M, Ahmad W. A frameshift variant in KIAA0825 causes postaxial polydactyly. Mol Syndromol. 2021 Mar;12(1):20–4. https://doi.org/10.1159/000512062
  59. Afzal M, Zaman Q, Kornak U, Mundlos S, Malik S, Flöttmann R. Novel splice mutation in LRP4 causes severe type of Cenani-Lenz syndactyly syndrome with oro-facial and skeletal symptoms. Eur J Med Genet. 2017 Aug;60(8):421–5. https://doi.org/10.1016/j.ejmg.2017.05.004
  60. Alrayes N, Aziz A, Ullah F, Ishfaq M, Jelani M, Wali A. Novel missense alteration in LRP4 gene underlies Cenani-Lenz syndactyly syndrome in a consanguineous family. J Gene Med. 2020 Jan;22(1):e3143. https://doi.org/10.1002/jgm.3143
  61. Khan H, Chong AE, Bilal M, Nawaz S, Abdullah, Abbasi S, et al. Novel variants in the LRP4 underlying Cenani-Lenz Syndactyly syndrome. J Hum Genet. 2022 May;67(5):253–9. https://doi.org/10.1038/s10038-021-00995-x
  62. Yasin S, Mustafa S, Ayesha A, Latif M, Hassan M, Faisal M, et al. A novel homozygous missense variant in MATN3 causes spondylo-epimetaphyseal dysplasia Matrilin 3 type in a consanguineous family. Eur J Med Genet. 2020 Aug;63(8):103958. https://doi.org/10.1016/j.ejmg.2020.103958
  63. Ullah A, Khalid M, Umair M, Khan SA, Bilal M, Khan S, et al. Novel sequence variants in the MKKS gene cause Bardet-Biedl syndrome with intra- and inter-familial variable phenotypes. Congenit Anom (Kyoto). 2018 Sep;58(5):173–5. https://doi.org/10.1111/cga.12264
  64. Ahmed S, Arif A, Abbas S, Khan MO, Kirmani S, Khan AH. Hajdu Cheney syndrome due to NOTCH2 defect - first case report from Pakistan and review of literature. Ann Med Surg (Lond). 2021 Jan;62:154–9. https://doi.org/10.1016/j.amsu.2021.01.041
  65. ul Ain N, Iqbal M, Valta H, Emerling CA, Ahmed S, Makitie O, et al. Novel variants in natriuretic peptide receptor 2 in unrelated patients with acromesomelic dysplasia type Maroteaux. Eur J Med Genet. 2019; 62(9):103554. https://doi.org/10.1016/j.ejmg.2018.10.006
  66. Irfanullah UM, Umair M, Khan S, Ahmad W. Homozygous sequence variants in the NPR2 gene underlying acromesomelic dysplasia maroteaux type (AMDM) in consanguineous families. Ann Hum Genet. 2015 Jul;79(4):238–44. https://doi.org/10.1111/ahg.12116
  67. Mustafa S, Akhtar Z, Latif M, Hassan M, Faisal M, Iqbal F. A novel nonsense mutation in NPR2 gene causing acromesomelic dysplasia, type maroteaux in a consanguineous family in Southern Punjab (Pakistan). Genes Genomics. 2020 Aug;42(8):847–54. https://doi.org/10.1007/s13258-020-00955-3
  68. Mustafa S, Hussain MF, Latif M, Ijaz M, Asif M, Hassan M, et al. A missense mutation (c.1037 G > C, p. R346P) in PAPSS2 gene results in autosomal recessive form of brachyolmia type 1 (Hobaek Form) in a consanguineous family. Genes (Basel). 2022 Nov;13(11):2096. https://doi.org/10.3390/genes13112096
  69. Iqbal M, Muhammad N, Ali SA, Kostjukovits S, Mäkitie O, Naz S. The Finnish founder mutation c.70 A>G in RMRP causes cartilage-hair hypoplasia in a Pakistani family. Clin Dysmorphol. 2017 Apr;26(2):121–3. https://doi.org/10.1097/MCD.0000000000000155
  70. Habib R, Amin-Ud-Din M, Ahmad W. A nonsense mutation in the gene ROR2 underlying autosomal dominant brachydactyly type B. Clin Dysmorphol. 2013 Apr;22(2):47–50. https://doi.org/10.1097/MCD.0b013e32835c6c8c
  71. Hayat A, Hussain S, Bilal M, Kausar M, Almuzzaini B, Abbas S, et al. Biallelic variants in four genes underlying recessive osteogenesis imperfecta. Eur J Med Genet. 2020 Aug;63(8):103954. https://doi.org/10.1016/j.ejmg.2020.103954
  72. Parveen A, Arif A, Arshad S, Rahman MS, Siddiqui FA, Awais M. Identification of osteogenesis imperfecta type VI: a first case report from a Pakistani family. J Pharm Res Int. 2021;33(60B):2532–9. https://doi.org/10.9734/jpri/2021/v33i60B34910
  73. Yousaf M, Khan R, Akram Z, Chaudhry QU, Iftikhar R. Primary hypertrophic osteoarthropathy with myelofibrosis. Cureus. 2022 Oct;14(10):e30108. https://doi.org/10.7759/cureus.30108
  74. Umair M, Bilal M, Ali RH, Alhaddad B, Ahmad F, Abdullah, et al. Whole-exome sequencing revealed a nonsense mutation in STKLD1 causing non-syndromic pre-axial polydactyly type A affecting only upper limb. Clin Genet. 2019b Aug;96(2):134–9. https://doi.org/10.1111/cge.13547
  75. Rafeeq MM, Murad HA, Najumuddin, Ullah S, Ahmed Z, Alam Q, et al. Case report: a novel de novo loss of function variant in the DNA-binding domain of TBX2 causes severe osteochondrodysplasia. Front Genet. 2023 Jan;13:1117500. https://doi.org/10.3389/fgene.2022.1117500
  76. Khaddour R, Smith U, Baala L, Martinovic J, Clavering D, Shaffiq R, et al. Spectrum of MKS1 and MKS3 mutations in Meckel syndrome: a genotype-phenotype correlation. Hum Mutat. 2007 May;28(5):523–4. https://doi.org/10.1002/humu.9489
  77. Bilal M, Hayat A, Umair M, Ullah A, Khawaja S, Malik E, et al. Sequence variants in the WNT10B and TP63 genes underlying isolated split-hand/split-foot malformation. Genet Test Mol Biomarkers. 2020 Sep;24(9):600–7. https://doi.org/10.1089/gtmb.2020.0024
  78. Kausar M, Siddiqi S, Yaqoob M, Mansoor S, Makitie O, Mir A, et al. Novel mutation G324C in WNT1 mapped in a large Pakistani family with severe recessively inherited osteogenesis imperfecta. J Biomed Sci. 2018 Nov;25(1):82. https://doi.org/10.1186/s12929-018-0481-x
  79. Ullah A, Gul A, Umair M, Irfanullah, Ahmad F, Aziz A, et al. Homozygous sequence variants in the WNT10B gene underlie split hand/foot malformation. Genet Mol Biol. 2018;41(1):1–8. https://doi.org/10.1590/1678-4685-gmb-2016-0162
  80. Khan A, Wang R, Han S, Umair M, Alshabeeb MA, Ansar M, et al. A novel homozygous nonsense mutation p. Cys366* in the WNT10B gene underlying split-hand/split foot malformation in a consanguineous Pakistani family. Front Pediatr. 2020 Jan;7:526. https://doi.org/10.3389/fped.2019.00526
  81. Ahmad Z, Liaqat R, Palander O, Bilal M, Zeb S, Ahmad F, et al. Genetic overview of postaxial polydactyly: updated classification. Clin Genet. 2023 Jan;103(1):3–15. https://doi.org/10.1111/cge.14224
  82. Umair M, Ahmad F, Bilal M, Ahmad W, Alfadhel M. Clinical genetics of polydactyly: an updated review. Front Genet. 2018 Nov;9:447. https://doi.org/10.3389/fgene.2018.00447
  83. Umair M, Waqas A. Undiagnosed rare genetic disorders: importance of functional characterization of variants. Genes (Basel). 2023 Jul;14(7):1469. https://doi.org/10.3390/genes14071469
  84. Umair M, Ahmad F, Ullah A. Whole exome sequencing as a diagnostic tool for genetic disorders in Pakistan. Pak J Med Res. 2018;57(2):90–1.
  85. Khan FZ, Mazhar SB. Current trends of consanguineous marriages and its association with socio-demographic variables in Pakistan. Int J Reprod Contracept Obstet Gynecol. 2018;7(5):1699–705. https://doi.org/10.18203/2320-1770.ijrcog20181898
  86. Unger S, Ferreira CR, Mortier GR, Ali H, Bertola DR, Calder A, et al. Nosology of genetic skeletal disorders: 2023 revision. Am J Med Genet A. 2023 May;191(5):1164–209. https://doi.org/10.1002/ajmg.a.63132
  87. Krakow D, Rimoin DL. The skeletal dysplasias. Genet Med. 2010 Jun;12(6):327–41. https://doi.org/10.1097/GIM.0b013e3181daae9b
  88. Spranger R, Gunst M, Kühn M. Polyorchidism: a strange anomaly with unsuspected properties. J Urol. 2002l Jul;168(1):198. https://doi.org/10.1016/S0022-5347(05)64868-9
  89. Kornak U, Mundlos S. Genetic disorders of the skeleton: a developmental approach. Am J Hum Genet. 2003 Sep;73(3):447–74. https://doi.org/10.1086/377110
  90. Zelzer E, Olsen BR. The genetic basis for skeletal diseases. Nature. 2003 May;423(6937):343–8. https://doi.org/10.1038/nature01659
  91. Mundlos S, Otto F, Mundlos C, Mulliken JB, Aylsworth AS, Albright S, et al. Mutations involving the transcription factor CBFA1 cause cleidocranial dysplasia. Cell. 1997 May;89(5):773–9. https://doi.org/10.1016/S0092-8674(00)80260-3
  92. Mundlos S, Olsen BR. Heritable diseases of the skeleton. Part II: molecular insights into skeletal development-matrix components and their homeostasis. FASEB J. 1997 Mar;11(4):227–33. https://doi.org/10.1096/fasebj.11.4.9068611
  93. Umair M, Younus M, Shafiq S, Nayab A, Alfadhel M. Clinical genetics of spondylocostal dysostosis: a mini review. Front Genet. 2022 Nov;13:996364. https://doi.org/10.3389/fgene.2022.996364
  94. Ben-Omran T, Al Ghanim K, Yavarna T, El Akoum M, Samara M, Chandra P, et al. Effects of consanguinity in a cohort of subjects with certain genetic disorders in Qatar. Mol Genet Genomic Med. 2020 Jan;8(1):e1051. https://doi.org/10.1002/mgg3.1051
  95. Umair M, Eckstein G, Rudolph G, Strom T, Graf E, Hendig D, et al. Homozygous XYLT2 variants as a cause of spondyloocular syndrome. Clin Genet. 2018 Apr;93(4):913–8. https://doi.org/10.1111/cge.13179


How to Cite this Article
Pubmed Style

Khan M, Umair M. Nosology of Genetic Skeletal Disorders, Pakistan: An Updated review. JBCGenetics. 2023; 6(2): 106-118. doi:10.24911/JBCGenetics/183-1696867179


Web Style

Khan M, Umair M. Nosology of Genetic Skeletal Disorders, Pakistan: An Updated review. https://www.jbcgenetics.com/?mno=172582 [Access: July 12, 2024]. doi:10.24911/JBCGenetics/183-1696867179


AMA (American Medical Association) Style

Khan M, Umair M. Nosology of Genetic Skeletal Disorders, Pakistan: An Updated review. JBCGenetics. 2023; 6(2): 106-118. doi:10.24911/JBCGenetics/183-1696867179



Vancouver/ICMJE Style

Khan M, Umair M. Nosology of Genetic Skeletal Disorders, Pakistan: An Updated review. JBCGenetics. (2023), [cited July 12, 2024]; 6(2): 106-118. doi:10.24911/JBCGenetics/183-1696867179



Harvard Style

Khan, M. & Umair, . M. (2023) Nosology of Genetic Skeletal Disorders, Pakistan: An Updated review. JBCGenetics, 6 (2), 106-118. doi:10.24911/JBCGenetics/183-1696867179



Turabian Style

Khan, Mujahid, and Muhammad Umair. 2023. Nosology of Genetic Skeletal Disorders, Pakistan: An Updated review. Journal of Biochemical and Clinical Genetics, 6 (2), 106-118. doi:10.24911/JBCGenetics/183-1696867179



Chicago Style

Khan, Mujahid, and Muhammad Umair. "Nosology of Genetic Skeletal Disorders, Pakistan: An Updated review." Journal of Biochemical and Clinical Genetics 6 (2023), 106-118. doi:10.24911/JBCGenetics/183-1696867179



MLA (The Modern Language Association) Style

Khan, Mujahid, and Muhammad Umair. "Nosology of Genetic Skeletal Disorders, Pakistan: An Updated review." Journal of Biochemical and Clinical Genetics 6.2 (2023), 106-118. Print. doi:10.24911/JBCGenetics/183-1696867179



APA (American Psychological Association) Style

Khan, M. & Umair, . M. (2023) Nosology of Genetic Skeletal Disorders, Pakistan: An Updated review. Journal of Biochemical and Clinical Genetics, 6 (2), 106-118. doi:10.24911/JBCGenetics/183-1696867179





Most Viewed Articles
Most Accessed Articles

  • Frontonasal dysplasia: a review
    Muhammad Umair, Farooq Ahmad, Muhammad Bilal, Muhammad Arshad
    JBCGenetics. 2018; 1(2): 66-76
    » Abstract » doi: 10.24911/JBCGenetics/183-1530765389

  • The role of C-terminal tensin-like (Cten) gene in cancer metastasis
    Saleh Alghamdi, Sarah Alkwai, Mohammad Ilyas
    JBCGenetics. 2018; 1(1): 2-9
    » Abstract » doi: 10.24911/JBCGenetics/183-1531548689

  • Clinical reassessment of post-laboratory variant call format (VCF) files
    Lamia Alsubaie, Saeed Alturki, Ali Alothaim, Ahmed Alfares
    JBCGenetics. 2018; 1(1): 31-36
    » Abstract » doi: 10.24911/JBCGenetics/183-1529928114

  • Microcephalic osteodysplastic primordial dwarfism type II and Klinefelter syndrome: report of two competing growth syndromes
    AlAnoud Al-Jarbou, Afnan Al-Turki, Suha Tashkandi, Eissa A. Faqeih
    JBCGenetics. 2018; 1(1): 37-39
    » Abstract » doi: 10.24911/JBCGenetics/183-1530040885

  • Recessive ARFGEF2 mutation causes progressive microcephaly, epilepsy, and a distinct MRI pattern
    Maram Alojair, Abdulaziz Alghamdi, Kalthoum Tlili, Sateesh Maddirevula, Fowzan Sami Alkuraya, Brahim Tabarki
    JBCGenetics. 2018; 1(1): 40-42
    » Abstract » doi: 10.24911/JBCGenetics/183-1531469195

  • Most Downloaded
    Top Downloaded Articles

  • Frontonasal dysplasia: a review
    Muhammad Umair, Farooq Ahmad, Muhammad Bilal, Muhammad Arshad
    JBCGenetics. 2018; 1(2): 66-76
    » Abstract » doi: 10.24911/JBCGenetics/183-1530765389

  • Generation of a mouse model of Primary Hyperoxaluria Type 1 via CRISPR/Cas9 mediated gene editing
    Kimberly A Coughlan, Rajanikanth J Maganti, Andrea Frassetto, Christine M DeAntonis, meredith Wolfrom, Anne-Renee Graham, Shawn M Hillier, Steven Fortucci, Hoor Al Jandal, Sue-Jean Hong, Paloma H Giangrande, Paolo GV Martini,
    JBCGenetics. 2019; 2(1): 28-39
    » Abstract » doi: 10.24911/JBCGenetics/183-1542047633

  • Syndactyly genes and classification: a mini review
    Muhammad Umair, Farooq Ahmad, Muhammad Bilal, Safdar Abbas
    JBCGenetics. 2018; 1(1): 10-18
    » Abstract » doi: 10.24911/JBCGenetics/183-1532177257

  • Recessive ARFGEF2 mutation causes progressive microcephaly, epilepsy, and a distinct MRI pattern
    Maram Alojair, Abdulaziz Alghamdi, Kalthoum Tlili, Sateesh Maddirevula, Fowzan Sami Alkuraya, Brahim Tabarki
    JBCGenetics. 2018; 1(1): 40-42
    » Abstract » doi: 10.24911/JBCGenetics/183-1531469195

  • Consanguinity, awareness, and genetic disorders among female university students in Riyadh, Saudi Arabia
    Hadil Alahdal, Huda Alshanbari, Hana Saud Almazroa, Sarah Majed Alayesh, Alaa Mohammad Alrhaili, Nora Alqubi, Fai Fahad Alzamil, Reem Albassam
    JBCGenetics. 2021; 4(1): 27-34
    » Abstract » doi: 10.24911/JBCGenetics/183-1601264923

  • Most Cited Articles
    Most Cited Articles

  • Frontonasal dysplasia: a review
    Muhammad Umair, Farooq Ahmad, Muhammad Bilal, Muhammad Arshad
    JBCGenetics. 2018; 1(2): 66-76
    » Abstract » doi: 10.24911/JBCGenetics/183-1530765389
    Cited : 4 times [Click to see citing articles]

  • Syndactyly genes and classification: a mini review
    Muhammad Umair, Farooq Ahmad, Muhammad Bilal, Safdar Abbas
    JBCGenetics. 2018; 1(1): 10-18
    » Abstract » doi: 10.24911/JBCGenetics/183-1532177257
    Cited : 4 times [Click to see citing articles]

  • Genomics in Saudi Arabia Call for Data-Sharing Policy
    Ahmed Alfares,
    JBCGenetics. 2018; 1(2): 51-52
    » Abstract » doi: 10.24911/JBCGenetics/183-1546945268
    Cited : 4 times [Click to see citing articles]

  • Consanguinity, awareness, and genetic disorders among female university students in Riyadh, Saudi Arabia
    Hadil Alahdal, Huda Alshanbari, Hana Saud Almazroa, Sarah Majed Alayesh, Alaa Mohammad Alrhaili, Nora Alqubi, Fai Fahad Alzamil, Reem Albassam
    JBCGenetics. 2021; 4(1): 27-34
    » Abstract » doi: 10.24911/JBCGenetics/183-1601264923
    Cited : 2 times [Click to see citing articles]

  • Harel-Yoon syndrome: the first case report from Saudi Arabia
    Alaa AlAyed, Manar A. Samman, Abdul Ali Peer-Zada, Mohammed Almannai
    JBCGenetics. 2020; 3(1): 22-27
    » Abstract » doi: 10.24911/JBCGenetics/183-1585816398
    Cited : 2 times [Click to see citing articles]